Loading video...

Video Failed to Load

Go Home

Issac Asimov on Right and Wrong

ProfCarlSagan's profile picture

Prof. Carl Sagan

71,168 subscribers

64,602 views • 6 months ago •via X (Twitter)

ArtsEducationScience & Technology
LIVE

Anya Rossi• Live Now

Private livecam show

0 Comments

No comments available

Comments from the original post will appear here

Related Videos

“For the first time we will be free, humanity will be free”—Issac Asimov, the last interview.
2:20

“For the first time we will be free, humanity will be free”—Issac Asimov, the last interview.

Brian Roemmele

26,154 views • 1 day ago

Issac Asimov on one reason why humanity must become a multi-planetary species in 1975. “The notion of fighting wars over real estate on Earth becomes a little too ridiculous to take seriously”
1:17

Issac Asimov on one reason why humanity must become a multi-planetary species in 1975. “The notion of fighting wars over real estate on Earth becomes a little too ridiculous to take seriously”

Brian Roemmele

52,912 views • 7 months ago

Issac Asimov's Take on religion and Morality.
1:18

Issac Asimov's Take on religion and Morality.

Prof. Carl Sagan

129,853 views • 1 year ago

“For the first time we will be free, humanity will be free”—Issac Asimov, the last interview. Our future is not utopian or dystopian, it is human. A thread 🧵:
2:20

“For the first time we will be free, humanity will be free”—Issac Asimov, the last interview. Our future is not utopian or dystopian, it is human. A thread 🧵:

Brian Roemmele

86,610 views • 1 year ago

Issac Kappy was right! ... #WeWantAnswers #IssacKappy #Pedowood #Hollywood #SaveTheChildren
6:54

Sensitive content

Issac Kappy was right! ... #WeWantAnswers #IssacKappy #Pedowood #Hollywood #SaveTheChildren

Isaac’s Army

116,674 views • 2 years ago

Issac Asimov on the convergence we should begin to think about. It is best to have this discussion now than after the fact. It is not easy answers but I have been thinking about this since he presented it in the 1960s.
1:22

Issac Asimov on the convergence we should begin to think about. It is best to have this discussion now than after the fact. It is not easy answers but I have been thinking about this since he presented it in the 1960s.

Brian Roemmele

62,897 views • 1 year ago

Who’s right and who is wrong? Lay it on me.
0:30

Sensitive content

Who’s right and who is wrong? Lay it on me.

Amiri King

202,103 views • 1 year ago

Isaac Asimov was born on this day in 1920.
1:47

Isaac Asimov was born on this day in 1920.

Humanoid History

41,923 views • 2 years ago

Walk On By Issac Hayes 🕊️ (1969)
3:11

Walk On By Issac Hayes 🕊️ (1969)

Rhythm & Blues 💎

33,563 views • 11 months ago

... in the last days wrong will be right and right will be wrong
0:56

... in the last days wrong will be right and right will be wrong

Peché Africa 🇿🇦

220,627 views • 1 year ago

Dr. Umar be right when he’s right. And wrong when he’s wrong 🤷🏾‍♀️
2:58

Dr. Umar be right when he’s right. And wrong when he’s wrong 🤷🏾‍♀️

BRE

2,109,925 views • 1 year ago

I’m on Georgia and the under, Kelly is on Notre Dame. I’m right, she’s wrong:
2:37

I’m on Georgia and the under, Kelly is on Notre Dame. I’m right, she’s wrong:

Clay Travis

202,450 views • 1 year ago

AI Predictions by Isaac Asimov on The MacNeil/Lehrer Report in 1982.
1:19

AI Predictions by Isaac Asimov on The MacNeil/Lehrer Report in 1982.

Massimo

70,874 views • 1 year ago

Asimov Press. Book Unboxing. Encoded in English and DNA. Designed by Everything Studio | Brooklyn, NY Printed by Shapco | Minneapolis, MN Published by Asimov Press | San Francisco, CA CATGATGACAGCTAGCGTCTAAGCCATTGTTGTTCGACG
0:37

Asimov Press. Book Unboxing. Encoded in English and DNA. Designed by Everything Studio | Brooklyn, NY Printed by Shapco | Minneapolis, MN Published by Asimov Press | San Francisco, CA CATGATGACAGCTAGCGTCTAAGCCATTGTTGTTCGACG

Niko McCarty.

11,460 views • 1 year ago

Another video from Day 179. Asimov is getting better and better.
0:49

Another video from Day 179. Asimov is getting better and better.

Asimov

37,619 views • 3 months ago

Disallowing Mian Nawaz Sharif to speak to his late wife on her death bed was totally wrong and not allowing Imran Khan to talk to his sons is also wrong. Two wrongs don’t make a right. Don’t say it was right then and wrong now or vice verse. Wrong then, wrong now.
2:53

Disallowing Mian Nawaz Sharif to speak to his late wife on her death bed was totally wrong and not allowing Imran Khan to talk to his sons is also wrong. Two wrongs don’t make a right. Don’t say it was right then and wrong now or vice verse. Wrong then, wrong now.

Miftah Ismail

62,139 views • 1 year ago

Matt Goodwin on Keir Starmer, he hits the nail right on the head! And he’s not wrong!
0:51

Matt Goodwin on Keir Starmer, he hits the nail right on the head! And he’s not wrong!

Agatha 🐈🏴󠁧󠁢󠁥󠁮󠁧󠁿🤍🇳🇴🤍🇺🇸 🙏🕊️✝️

36,117 views • 1 year ago

Day 213 of building Asimov, an open-source humanoid. We controlled Asimov v1 in Singapore from HCMC, Vietnam.
0:50

Day 213 of building Asimov, an open-source humanoid. We controlled Asimov v1 in Singapore from HCMC, Vietnam.

Asimov

11,342 views • 2 months ago

“Right is right, wrong is wrong, and Trump's wrong.” Former Marine Brian McGinnis, whose hand was broken by police and a congressman earlier this month in a protest at the US Capitol, says Donald Trump is “wrong” when it comes to the joint US-Israeli war on Iran.
1:07

“Right is right, wrong is wrong, and Trump's wrong.” Former Marine Brian McGinnis, whose hand was broken by police and a congressman earlier this month in a protest at the US Capitol, says Donald Trump is “wrong” when it comes to the joint US-Israeli war on Iran.

Al Jazeera English

83,030 views • 3 months ago