Загрузка видео...

Не удалось загрузить видео

На главную

Issac Asimov on Right and Wrong

ProfCarlSagan's profile picture

Prof. Carl Sagan

71,168 subscribers

64,602 просмотров • 5 месяцев назад •via X (Twitter)

ИскусствоОбразованиеНаука и технологии
LIVE

Anya Rossi• Live Now

Private livecam show

Комментарии: 0

Нет доступных комментариев

Здесь появятся комментарии из оригинального поста

Похожие видео

Issac Asimov on one reason why humanity must become a multi-planetary species in 1975. “The notion of fighting wars over real estate on Earth becomes a little too ridiculous to take seriously”
1:17

Issac Asimov on one reason why humanity must become a multi-planetary species in 1975. “The notion of fighting wars over real estate on Earth becomes a little too ridiculous to take seriously”

Brian Roemmele

52,912 просмотров • 7 месяцев назад

“For the first time we will be free, humanity will be free”—Issac Asimov, the last interview. Our future is not utopian or dystopian, it is human.
2:20

“For the first time we will be free, humanity will be free”—Issac Asimov, the last interview. Our future is not utopian or dystopian, it is human.

Brian Roemmele

22,135 просмотров • 3 месяцев назад

Issac Asimov's Take on religion and Morality.
1:18

Issac Asimov's Take on religion and Morality.

Prof. Carl Sagan

129,853 просмотров • 1 год назад

“For the first time we will be free, humanity will be free”—Issac Asimov, the last interview. Our future is not utopian or dystopian, it is human. A thread 🧵:
2:20

“For the first time we will be free, humanity will be free”—Issac Asimov, the last interview. Our future is not utopian or dystopian, it is human. A thread 🧵:

Brian Roemmele

86,610 просмотров • 1 год назад

Issac Kappy was right! ... #WeWantAnswers #IssacKappy #Pedowood #Hollywood #SaveTheChildren
6:54

Sensitive content

Issac Kappy was right! ... #WeWantAnswers #IssacKappy #Pedowood #Hollywood #SaveTheChildren

Isaac’s Army

116,674 просмотров • 2 лет назад

Issac Asimov on the convergence we should begin to think about. It is best to have this discussion now than after the fact. It is not easy answers but I have been thinking about this since he presented it in the 1960s.
1:22

Issac Asimov on the convergence we should begin to think about. It is best to have this discussion now than after the fact. It is not easy answers but I have been thinking about this since he presented it in the 1960s.

Brian Roemmele

62,897 просмотров • 1 год назад

Isaac Asimov was born on this day in 1920.
1:47

Isaac Asimov was born on this day in 1920.

Humanoid History

41,923 просмотров • 2 лет назад

Who’s right and who is wrong? Lay it on me.
0:30

Sensitive content

Who’s right and who is wrong? Lay it on me.

Amiri King

202,103 просмотров • 1 год назад

Walk On By Issac Hayes 🕊️ (1969)
3:11

Walk On By Issac Hayes 🕊️ (1969)

Rhythm & Blues 💎

33,563 просмотров • 10 месяцев назад

Dr. Umar be right when he’s right. And wrong when he’s wrong 🤷🏾‍♀️
2:58

Dr. Umar be right when he’s right. And wrong when he’s wrong 🤷🏾‍♀️

BRE

2,109,845 просмотров • 1 год назад

... in the last days wrong will be right and right will be wrong
0:56

... in the last days wrong will be right and right will be wrong

Peché Africa 🇿🇦

220,475 просмотров • 1 год назад

I’m on Georgia and the under, Kelly is on Notre Dame. I’m right, she’s wrong:
2:37

I’m on Georgia and the under, Kelly is on Notre Dame. I’m right, she’s wrong:

Clay Travis

202,450 просмотров • 1 год назад

AI Predictions by Isaac Asimov on The MacNeil/Lehrer Report in 1982.
1:19

AI Predictions by Isaac Asimov on The MacNeil/Lehrer Report in 1982.

Massimo

70,874 просмотров • 1 год назад

Asimov Press. Book Unboxing. Encoded in English and DNA. Designed by Everything Studio | Brooklyn, NY Printed by Shapco | Minneapolis, MN Published by Asimov Press | San Francisco, CA CATGATGACAGCTAGCGTCTAAGCCATTGTTGTTCGACG
0:37

Asimov Press. Book Unboxing. Encoded in English and DNA. Designed by Everything Studio | Brooklyn, NY Printed by Shapco | Minneapolis, MN Published by Asimov Press | San Francisco, CA CATGATGACAGCTAGCGTCTAAGCCATTGTTGTTCGACG

Niko McCarty.

11,460 просмотров • 1 год назад

Disallowing Mian Nawaz Sharif to speak to his late wife on her death bed was totally wrong and not allowing Imran Khan to talk to his sons is also wrong. Two wrongs don’t make a right. Don’t say it was right then and wrong now or vice verse. Wrong then, wrong now.
2:53

Disallowing Mian Nawaz Sharif to speak to his late wife on her death bed was totally wrong and not allowing Imran Khan to talk to his sons is also wrong. Two wrongs don’t make a right. Don’t say it was right then and wrong now or vice verse. Wrong then, wrong now.

Miftah Ismail

62,139 просмотров • 1 год назад

Matt Goodwin on Keir Starmer, he hits the nail right on the head! And he’s not wrong!
0:51

Matt Goodwin on Keir Starmer, he hits the nail right on the head! And he’s not wrong!

Agatha 🐈🏴󠁧󠁢󠁥󠁮󠁧󠁿🤍🇳🇴🤍🇺🇸 🙏🕊️✝️

36,117 просмотров • 1 год назад

Another video from Day 179. Asimov is getting better and better.
0:49

Another video from Day 179. Asimov is getting better and better.

Asimov

37,550 просмотров • 3 месяцев назад

“Right is right, wrong is wrong, and Trump's wrong.” Former Marine Brian McGinnis, whose hand was broken by police and a congressman earlier this month in a protest at the US Capitol, says Donald Trump is “wrong” when it comes to the joint US-Israeli war on Iran.
1:07

“Right is right, wrong is wrong, and Trump's wrong.” Former Marine Brian McGinnis, whose hand was broken by police and a congressman earlier this month in a protest at the US Capitol, says Donald Trump is “wrong” when it comes to the joint US-Israeli war on Iran.

Al Jazeera English

83,030 просмотров • 3 месяцев назад

F**k right and left...let's get back to right and wrong
7:08

F**k right and left...let's get back to right and wrong

Christopher C. Cuomo

66,632 просмотров • 9 месяцев назад