Video yükleniyor...

Video Yüklenemedi

Ana Sayfaya Dön

English font designed by Dmitry Lamonov.

sciencegirl's profile picture

Science girl

5,815,700 subscribers

3,091,289 görüntüleme • 11 ay önce •via X (Twitter)

Bilim & TeknolojiEğitimSanat
LIVE

Anya Rossi• Live Now

Private livecam show

0 Yorum

Yorum bulunmuyor

Orijinal gönderinin yorumları burada görünecek

Benzer Videolar

How to write 🖤 font alphabet from A to Z [🖊️ Dmitry Lamonov]
1:20

How to write 🖤 font alphabet from A to Z [🖊️ Dmitry Lamonov]

Massimo

384,378 görüntüleme • 11 ay önce

English spelling and pronunciation were designed by committee and that committee hated each other.
0:46

English spelling and pronunciation were designed by committee and that committee hated each other.

Lloyd Legalist

35,641 görüntüleme • 4 ay önce

How to write Amazing English Font
1:12

How to write Amazing English Font

uma

1,629,166 görüntüleme • 1 ay önce

Asimov Press. Book Unboxing. Encoded in English and DNA. Designed by Everything Studio | Brooklyn, NY Printed by Shapco | Minneapolis, MN Published by Asimov Press | San Francisco, CA CATGATGACAGCTAGCGTCTAAGCCATTGTTGTTCGACG
0:37

Asimov Press. Book Unboxing. Encoded in English and DNA. Designed by Everything Studio | Brooklyn, NY Printed by Shapco | Minneapolis, MN Published by Asimov Press | San Francisco, CA CATGATGACAGCTAGCGTCTAAGCCATTGTTGTTCGACG

Niko McCarty.

11,460 görüntüleme • 1 yıl önce

Connor Bedard gets stapled by Dmitry Kulikov and a melee ensues! 🌀
0:41

Connor Bedard gets stapled by Dmitry Kulikov and a melee ensues! 🌀

Sportsnet

279,864 görüntüleme • 2 yıl önce

🚨 Supreme Power X Ultimate Fear has been uploaded in English Font as well!! Season 3 Releases October 🎉
0:24

🚨 Supreme Power X Ultimate Fear has been uploaded in English Font as well!! Season 3 Releases October 🎉

One Peak Man

22,565 görüntüleme • 11 ay önce

braille font created by Kosuke Takahashi.
1:54

braille font created by Kosuke Takahashi.

Science girl

719,866 görüntüleme • 9 ay önce

Hearing a German try to learn English makes me remember just how stupidly our language is designed
1:10

Hearing a German try to learn English makes me remember just how stupidly our language is designed

internet hall of fame

856,514 görüntüleme • 3 ay önce

Zelensky leaving a press conference escorted by British security, the video clearly shows a security officer with SSPU (Special Operation United Kingdom) patch at 0:25. Dmitry Rogozin said that the entire entourage speaks English. Head of Mi6 Richard Moore is Zelensky's handler.
2:12

Zelensky leaving a press conference escorted by British security, the video clearly shows a security officer with SSPU (Special Operation United Kingdom) patch at 0:25. Dmitry Rogozin said that the entire entourage speaks English. Head of Mi6 Richard Moore is Zelensky's handler.

TeeJay

20,947 görüntüleme • 8 ay önce

JUST IN: 🇷🇺 Russia's Dmitry Medvedev says Europe is run by a gang of lunatics.
0:51

JUST IN: 🇷🇺 Russia's Dmitry Medvedev says Europe is run by a gang of lunatics.

BRICS News

378,410 görüntüleme • 5 ay önce

Designed by yours truly
0:47

Designed by yours truly

Gamer_Architect

18,691 görüntüleme • 1 ay önce

New font! AR One Sans designed by Niteesh Yadav ( नितीश ) for Augmented Reality (AR) environments and UIs with high-readability in busy backgrounds. Includes axes for Weight and also a special 'AR Retinal Resolution' axis. ARRR! 📱
0:34

New font! AR One Sans designed by Niteesh Yadav ( नितीश ) for Augmented Reality (AR) environments and UIs with high-readability in busy backgrounds. Includes axes for Weight and also a special 'AR Retinal Resolution' axis. ARRR! 📱

Google Fonts

115,037 görüntüleme • 2 yıl önce

In the 1970s, Italian singer Adriano Celentano created a hit song in gibberish designed to sound like English
0:44

In the 1970s, Italian singer Adriano Celentano created a hit song in gibberish designed to sound like English

Massimo

28,897 görüntüleme • 4 ay önce

Luxury toilets designed by AI
0:20

Luxury toilets designed by AI

Interesting As Fuck

79,503 görüntüleme • 1 yıl önce

Russia also sent a high-level delegation, led by former Russian President Dmitry Medvedev, to Khamenei’s funeral.
0:41

Russia also sent a high-level delegation, led by former Russian President Dmitry Medvedev, to Khamenei’s funeral.

Republicans against Trump

37,319 görüntüleme • 7 gün önce

An English man gets pulled over by English police for possessing English flags... in England. 🤡
0:40

An English man gets pulled over by English police for possessing English flags... in England. 🤡

Wide Awake Media

30,551 görüntüleme • 10 ay önce

4 years ago, Dmitry Bivol defeated Saúl Álvarez by UD12 to retain the WBA light heavyweight title.
2:13

4 years ago, Dmitry Bivol defeated Saúl Álvarez by UD12 to retain the WBA light heavyweight title.

ᴋᴀʏᴏ ✘

84,088 görüntüleme • 2 ay önce

For English speakers who are not afraid by my poor English
7:01

For English speakers who are not afraid by my poor English

Stratpol

21,188 görüntüleme • 1 yıl önce

iOS but Designed by Teenage Engineering
0:22

iOS but Designed by Teenage Engineering

Apple Design

1,948,560 görüntüleme • 1 yıl önce