Niko McCarty.'s banner

Niko McCarty.

@NikoMcCarty • 49,749 subscribers

Fellow at @AsteraInstitute // Founding Editor @AsimovPress

Shorts

Beauty should be a core pursuit of biotechnology. There should be companies and nonprofits that engineer organisms solely for the sake of crafting beautiful things. A few reasons why: 1/ Biotechnology has historically worked in reductionist ways, but many useful functions only emerge at the systems level. By engineering a systems-level outcome, like beauty, we will get much better at engineering organisms in predictable ways. When I say "reductionist," I mean that most useful things in biotechnology (drugs and tools) were discovered by stripping molecules from their natural contexts. Scientists collect organisms from soil or wherever and then study their molecules in isolation. This basic approach has yielded everything from rapamycin to antibiotics and CRISPR. This reductionism, though, means that that we know disturbingly little about how life actually works at a systems-level. My core argument is that, by studying beauty, we can remedy this. Beauty has persisted through tens of millions of years of evolution because it is functional; bright colors help attract pollinators to a plant, for example, which helps the plant breed. If evolution has created all of this beauty for functional reasons, then it stands to reason that by trying to create **new** forms of beauty, we'll be able to discover and understand how these systems-level functions work! Indeed, we may even be able to create entirely new functions that biology hasn't evolved yet. These functions will not possible to understand via isolated molecules or reductionism. Therefore, a company pursuing engineered beauty for the sake of beauty will probably make many fundamental discoveries about how organisms develop, interact, adapt to their surroundings, and so on. 2/ Beauty is a way to grow the field and bring more people into biotechnology. Nick Desnoyer’s flower design work, for example, has probably reached hundreds of thousands of people. The glowing plants from Light Bio, too, were featured in the mainstream press. You may not think that these examples are “important” for the universe relative to, say, an incrementally better cancer therapeutic, but there’s no question that they are way more popular to mainstream audiences and good, overall, for the field. 3/ The market is huge! Breeding is already widely used to engineer beauty, or at least to select for aesthetic preferences. Pugs are evolutionarily suboptimal, but they've been bred precisely to satisfy a certain aesthetic desire are now a multi-billion dollar industry. The Juliet Rose, developed via breeding over a 15-year period, debuted at the 2006 Chelsea Flower Show and is enormously profitable today. Why should deliberately engineered forms of beauty be any different? If you are building a biotech company or nonprofit that is pursuing beauty, please reach out! I’d love to help.

Beauty should be a core pursuit of biotechnology. There should be companies and nonprofits that engineer organisms solely for the sake of crafting beautiful things. A few reasons why: 1/ Biotechnology has historically worked in reductionist ways, but many useful functions only emerge at the systems level. By engineering a systems-level outcome, like beauty, we will get much better at engineering organisms in predictable ways. When I say "reductionist," I mean that most useful things in biotechnology (drugs and tools) were discovered by stripping molecules from their natural contexts. Scientists collect organisms from soil or wherever and then study their molecules in isolation. This basic approach has yielded everything from rapamycin to antibiotics and CRISPR. This reductionism, though, means that that we know disturbingly little about how life actually works at a systems-level. My core argument is that, by studying beauty, we can remedy this. Beauty has persisted through tens of millions of years of evolution because it is functional; bright colors help attract pollinators to a plant, for example, which helps the plant breed. If evolution has created all of this beauty for functional reasons, then it stands to reason that by trying to create new forms of beauty, we'll be able to discover and understand how these systems-level functions work! Indeed, we may even be able to create entirely new functions that biology hasn't evolved yet. These functions will not possible to understand via isolated molecules or reductionism. Therefore, a company pursuing engineered beauty for the sake of beauty will probably make many fundamental discoveries about how organisms develop, interact, adapt to their surroundings, and so on. 2/ Beauty is a way to grow the field and bring more people into biotechnology. Nick Desnoyer’s flower design work, for example, has probably reached hundreds of thousands of people. The glowing plants from Light Bio, too, were featured in the mainstream press. You may not think that these examples are “important” for the universe relative to, say, an incrementally better cancer therapeutic, but there’s no question that they are way more popular to mainstream audiences and good, overall, for the field. 3/ The market is huge! Breeding is already widely used to engineer beauty, or at least to select for aesthetic preferences. Pugs are evolutionarily suboptimal, but they've been bred precisely to satisfy a certain aesthetic desire are now a multi-billion dollar industry. The Juliet Rose, developed via breeding over a 15-year period, debuted at the 2006 Chelsea Flower Show and is enormously profitable today. Why should deliberately engineered forms of beauty be any different? If you are building a biotech company or nonprofit that is pursuing beauty, please reach out! I’d love to help.

17,617 Aufrufe

I've been editing this article about "brain mapping" and connectomics, and I'm just stunned by how quickly the cost estimates to map, say, a mouse brain have plummeted in just the last couple years. It actually seems feasible that we could map the entire human brain -- all 86 billion neurons, and their connections -- in this lifetime. In the 1970s, Sydney Brenner started mapping all the connections between neurons in C. elegans. His team sliced the worm into thin pieces, took photos using an electron microscope, and manually traced and reconstructed each synapse for 302 neurons total. This project took more than a decade of work, and it cost about $16,500 to reconstruct each neuron. Scaling this up to a human brain boggles the mind. Electron microscopy remained the norm in connectomics for decades, because it was the only option available to see synapses at a resolution high enough to be able to trace their paths. Each electron microscope costs several hundreds of thousands of dollars, though, and you need lots of them to map even a mouse brain in a reasonable timeframe. In 2023, the Wellcome Trust released a report estimating how long, and how expensive, it would be to map the mouse connectome (~70M neurons). They estimated that imaging alone would cost $200-300M, and that proofreading (or ensuring that traces between neurons are correct) would cost $7-21 BILLION. (A human can only manually trace about 1 mm of neuron per hour.) Also, the images would occupy about 500 petabytes of data, and getting those data would require 20 electron microscopes running in parallel for about 5 years, continuously. They estimated the whole project would take about 17 years of work. This is, understandably, insane. But now it seems like there's an actual path toward mapping the full mouse brain in about five years for ~$100M dollars. There have been three major breakthroughs in the last year or so: 1/ Expansion microscopy, first developed in 2015, showed that it's possible to "enlarge" the brain by about 5x using a swellable polymer. But an improved method increases this number to >20x expansion, meaning we can now expand brains and image neurons much more easily using cheap light microscopes, rather than expensive electron ones. 2/ E11 Bio (a nonprofit research org) developed protein barcodes that get delivered into brain tissue; each neuron gets a unique combination of barcodes. These cells are then stained with colorful antibodies, which stick to a matching protein barcode, causing each neuron to light up in a distinct color. This makes tracing neurons so much easier. 3/ Google Research released PATHFINDER this May, an AI-based neuron tracing tool that can proofread about 67,200 cubic microns of brain tissue per hour, with very high accuracy. It works on electron micrographs, but something similar could be presumably be developed for the E11 / colorful tag approach. This is an extremely exciting time for neuroscience. (C. elegans connectome below.)

I've been editing this article about "brain mapping" and connectomics, and I'm just stunned by how quickly the cost estimates to map, say, a mouse brain have plummeted in just the last couple years. It actually seems feasible that we could map the entire human brain -- all 86 billion neurons, and their connections -- in this lifetime. In the 1970s, Sydney Brenner started mapping all the connections between neurons in C. elegans. His team sliced the worm into thin pieces, took photos using an electron microscope, and manually traced and reconstructed each synapse for 302 neurons total. This project took more than a decade of work, and it cost about $16,500 to reconstruct each neuron. Scaling this up to a human brain boggles the mind. Electron microscopy remained the norm in connectomics for decades, because it was the only option available to see synapses at a resolution high enough to be able to trace their paths. Each electron microscope costs several hundreds of thousands of dollars, though, and you need lots of them to map even a mouse brain in a reasonable timeframe. In 2023, the Wellcome Trust released a report estimating how long, and how expensive, it would be to map the mouse connectome (~70M neurons). They estimated that imaging alone would cost $200-300M, and that proofreading (or ensuring that traces between neurons are correct) would cost $7-21 BILLION. (A human can only manually trace about 1 mm of neuron per hour.) Also, the images would occupy about 500 petabytes of data, and getting those data would require 20 electron microscopes running in parallel for about 5 years, continuously. They estimated the whole project would take about 17 years of work. This is, understandably, insane. But now it seems like there's an actual path toward mapping the full mouse brain in about five years for ~$100M dollars. There have been three major breakthroughs in the last year or so: 1/ Expansion microscopy, first developed in 2015, showed that it's possible to "enlarge" the brain by about 5x using a swellable polymer. But an improved method increases this number to >20x expansion, meaning we can now expand brains and image neurons much more easily using cheap light microscopes, rather than expensive electron ones. 2/ E11 Bio (a nonprofit research org) developed protein barcodes that get delivered into brain tissue; each neuron gets a unique combination of barcodes. These cells are then stained with colorful antibodies, which stick to a matching protein barcode, causing each neuron to light up in a distinct color. This makes tracing neurons so much easier. 3/ Google Research released PATHFINDER this May, an AI-based neuron tracing tool that can proofread about 67,200 cubic microns of brain tissue per hour, with very high accuracy. It works on electron micrographs, but something similar could be presumably be developed for the E11 / colorful tag approach. This is an extremely exciting time for neuroscience. (C. elegans connectome below.)

66,819 Aufrufe

There's a bacteriophage that turns bacteria into “liquid crystals.” Specifically, Pseudomonas aeruginosa bacteria make Pf phages, which are rod-shaped, negatively-charged, and measure about 2 micrometers in length (roughly the length of an E. coli cell). These phages leave the cells and enter their surroundings. There, they mix with polymers, also secreted by the cells, to form a crystalline matrix. Surprisingly, this is good for the cells. Although the phages kill some of them, it also makes their biofilms stickier and able to withstand certain antibiotics. These bacteria + phages are prevalent in cystic fibrosis patients; they've formed a sort of symbiotic relationship. The Pf phages are made from thousands of repeating copies of a coat protein, called CoaB, which wraps around a single-stranded, circular DNA genome. These genes are integrated directly on the bacterial chromosome. The bacteria “turn on” these phage genes when placed in a viscous environment with low oxygen levels. This is like a trigger to start forming a biofilm. And the cells make a lot of phages; about 100 billion per milliliter. These liquid crystals form because of a physics principle called “depletion attraction.” If you just mix a bunch of loose or flexible polymers together (such as long carbon chains) they will not form a liquid crystal. But if you mix stiff rods (the phages) with loose polymers at a high enough concentration, the polymers will force the phages close together to create a material that flows like a liquid despite being ordered like a crystal. See the video below. These liquid crystal biofilms are hard to get rid of. The negatively-charged phages block many antibiotics (like aminoglycosides, which are positively-charged) from entering cells. Liquid crystals also retain water, so these biofilms can survive on drier surfaces. I first heard about this from Malmesbury’s excellent newsletter, called “Telescopic Turnip.”

There's a bacteriophage that turns bacteria into “liquid crystals.” Specifically, Pseudomonas aeruginosa bacteria make Pf phages, which are rod-shaped, negatively-charged, and measure about 2 micrometers in length (roughly the length of an E. coli cell). These phages leave the cells and enter their surroundings. There, they mix with polymers, also secreted by the cells, to form a crystalline matrix. Surprisingly, this is good for the cells. Although the phages kill some of them, it also makes their biofilms stickier and able to withstand certain antibiotics. These bacteria + phages are prevalent in cystic fibrosis patients; they've formed a sort of symbiotic relationship. The Pf phages are made from thousands of repeating copies of a coat protein, called CoaB, which wraps around a single-stranded, circular DNA genome. These genes are integrated directly on the bacterial chromosome. The bacteria “turn on” these phage genes when placed in a viscous environment with low oxygen levels. This is like a trigger to start forming a biofilm. And the cells make a lot of phages; about 100 billion per milliliter. These liquid crystals form because of a physics principle called “depletion attraction.” If you just mix a bunch of loose or flexible polymers together (such as long carbon chains) they will not form a liquid crystal. But if you mix stiff rods (the phages) with loose polymers at a high enough concentration, the polymers will force the phages close together to create a material that flows like a liquid despite being ordered like a crystal. See the video below. These liquid crystal biofilms are hard to get rid of. The negatively-charged phages block many antibiotics (like aminoglycosides, which are positively-charged) from entering cells. Liquid crystals also retain water, so these biofilms can survive on drier surfaces. I first heard about this from Malmesbury’s excellent newsletter, called “Telescopic Turnip.”

50,004 Aufrufe

This is beautiful. Making one protein, from one mRNA, takes minutes. This method images single mRNAs as they are translated by ribosomes. And can do it for >1 hour. Translation is start-stop; not continuous. (mRNAs = red; translation sites = green).

This is beautiful. Making one protein, from one mRNA, takes minutes. This method images single mRNAs as they are translated by ribosomes. And can do it for >1 hour. Translation is start-stop; not continuous. (mRNAs = red; translation sites = green).

168,744 Aufrufe

A single E. coli cell, placed on a dish, will become 70 billion cells in just 12 hours. That’s exponential growth. But a new preprint shows that it's possible to engineer E. coli to grow linearly instead, where only one daughter cell continues dividing and the other stops. First, some context. In nature, there is a bacterium called Mycobacterium smegmatis (initially discovered in 1884 in ulcers scraped from syphilis patients.) M. smegmatis is weird because it divides asymmetrically. These cells grow only from one end, and all their cell wall biosynthesis machinery is located on that one end. So when the cell divides, one daughter gets this machinery and the other gets nothing. The daughter that gets the machinery can keep dividing immediately, but the other daughter has to remake all that machinery from scratch, so its growth is delayed. E. coli doesn’t grow like this. When it divides, it pinches in the middle and splits everything evenly. Enzymes, metabolites, and proteins get partitioned more or less randomly between the two daughters. For the new preprint, though, researchers engineered E. coli to behave more like M. smegmatis. Here is how they did it: First, they deleted a gene called cyaA, which encodes an enzyme (adenylate cyclase) that makes a molecule called cAMP. cAMP is SUPER IMPORTANT! It is a nutrient sensor that instructs E. coli to switch on genes that help it digest non-glucose carbon sources when glucose is scarce. Without cAMP, E. coli cells growing on alternative carbon sources will starve; they won’t know how to eat the food. Next, they added back a “split” version of the cyaA gene into the cells. In other words, they split the gene in two so that each half of the enzyme is made separately. Cells can only make cAMP, and thus eat non-glucose carbon sources, if these two halves come together. To facilitate that “coming together,” the researchers also fused the split cyaA proteins to sticky proteins that clump together, and to a fluorescent protein (to make it easy to track these molecules in the cell.) So now some interesting things start to happen if you grow E. coli on a growth medium lacking glucose. As the cell grows, its cyaA “halves” start clumping together into a giant ball. Inside the aggregate, the two enzyme halves come together and make cAMP. And when the cell gets big enough and divides, the clump of cyaA RANDOMLY goes to either daughter cell #1 or #2. The daughter that gets the aggregate (called PA+ in this paper) can keep dividing. The daughter that doesn’t (PA–) cannot. It still grows a few times — about four divisions — because it inherits some leftover cAMP from its mother. But after that, the metabolite is diluted away, and the cell stops growing. PA+ cells went through about 23 divisions on average before their aggregate decayed. And the population of cells, as a whole, grew linearly. This paper is cool because there are many applications where exponential growth is too unpredictable and, perhaps, unsafe. If you want to engineer bacteria to deliver drugs, clean up waste, or live in the gut, you don’t want them to double uncontrollably. This paper shows you can make them expand in a controlled, linear way. Alas, mutations could break this whole engineered system. A mutation that restores cyaA, for example, would give cells a new way to make cAMP. Mutations that make the aggregates split between daughters would break the asymmetry, too. But still, I really enjoy proof-of-concept engineering papers like this.

A single E. coli cell, placed on a dish, will become 70 billion cells in just 12 hours. That’s exponential growth. But a new preprint shows that it's possible to engineer E. coli to grow linearly instead, where only one daughter cell continues dividing and the other stops. First, some context. In nature, there is a bacterium called Mycobacterium smegmatis (initially discovered in 1884 in ulcers scraped from syphilis patients.) M. smegmatis is weird because it divides asymmetrically. These cells grow only from one end, and all their cell wall biosynthesis machinery is located on that one end. So when the cell divides, one daughter gets this machinery and the other gets nothing. The daughter that gets the machinery can keep dividing immediately, but the other daughter has to remake all that machinery from scratch, so its growth is delayed. E. coli doesn’t grow like this. When it divides, it pinches in the middle and splits everything evenly. Enzymes, metabolites, and proteins get partitioned more or less randomly between the two daughters. For the new preprint, though, researchers engineered E. coli to behave more like M. smegmatis. Here is how they did it: First, they deleted a gene called cyaA, which encodes an enzyme (adenylate cyclase) that makes a molecule called cAMP. cAMP is SUPER IMPORTANT! It is a nutrient sensor that instructs E. coli to switch on genes that help it digest non-glucose carbon sources when glucose is scarce. Without cAMP, E. coli cells growing on alternative carbon sources will starve; they won’t know how to eat the food. Next, they added back a “split” version of the cyaA gene into the cells. In other words, they split the gene in two so that each half of the enzyme is made separately. Cells can only make cAMP, and thus eat non-glucose carbon sources, if these two halves come together. To facilitate that “coming together,” the researchers also fused the split cyaA proteins to sticky proteins that clump together, and to a fluorescent protein (to make it easy to track these molecules in the cell.) So now some interesting things start to happen if you grow E. coli on a growth medium lacking glucose. As the cell grows, its cyaA “halves” start clumping together into a giant ball. Inside the aggregate, the two enzyme halves come together and make cAMP. And when the cell gets big enough and divides, the clump of cyaA RANDOMLY goes to either daughter cell #1 or #2. The daughter that gets the aggregate (called PA+ in this paper) can keep dividing. The daughter that doesn’t (PA–) cannot. It still grows a few times — about four divisions — because it inherits some leftover cAMP from its mother. But after that, the metabolite is diluted away, and the cell stops growing. PA+ cells went through about 23 divisions on average before their aggregate decayed. And the population of cells, as a whole, grew linearly. This paper is cool because there are many applications where exponential growth is too unpredictable and, perhaps, unsafe. If you want to engineer bacteria to deliver drugs, clean up waste, or live in the gut, you don’t want them to double uncontrollably. This paper shows you can make them expand in a controlled, linear way. Alas, mutations could break this whole engineered system. A mutation that restores cyaA, for example, would give cells a new way to make cAMP. Mutations that make the aggregates split between daughters would break the asymmetry, too. But still, I really enjoy proof-of-concept engineering papers like this.

57,886 Aufrufe

The bacterial flagellum looks like a simple tail, or whip. But it’s actually a rotating motor, and perhaps the most sophisticated protein complex nature has ever evolved. In e. coli, these motors are capable of astonishing speeds; about 15,000 rpm. (The world record, according to one study, is for a Vibrio cell that was “clocked at 100,000 rpm by laser microscopy.) The flagellum propels the cell forward at speeds of 20-30 microns per second, or roughly 15 body lengths per second. If scaled up to the size of a cheetah, E. coli would *nearly* be the fastest land organism. The darting movements of a microbe were first observed in 1676 by Antony van Leeuwenhoek, a Dutch cloth merchant. Antony was delighted by the motion of his “animalcules,” writing: “I must say, for my part, that no more pleasant sight has ever yet come before my eye than these many thousands of living creatures, seen all alive in a little drop of water, moving among one another, each several creature having its own proper motion.” But Leeuwenhoek did not see flagella. He assumed, rather, that these animalcules must be “furnished with paws” instead. Christian Ehrenberg would not properly describe flagella until 1836. But amazingly, all the way up until the 1970s, nobody actually knew how the flagellum spun! In 1973, there were two competing models people argued over: the helical-wave (bending) model and the rotating (corkscrew) model. The first model suggested that the flagellum whipped back and forth, side-to-side, to propel the cell like paddle. The corkscrew model suggested that the whole flagellum instead spins around like a screw. In 1974, the corkscrew model finally won out. For two separate studies, scientists affixed flagella to glass slides using antibodies, and watched as the cells spun around and around like corkscrews. And finally, in just the last year, high-resolution structures of the flagellum have revealed a LOT more about its intricate assembly. The tail is made from ~20,000 self-assembling copies of a single protein, called flagellin. A “driveshaft,” or rod, spins the tail and is itself made of 26 protein subunits. Each “motor” in E. coli consists of 11 stators, each of which is made from 7 proteins.(Other types of cells have even more stators, and swim with much higher torques.) The flagellum spins when protons flow into the cell through tiny channels in these stators; akin to water running through a turbine. Each proton makes a small part of the stator change shape and push against the rotor, nudging it forward one step. With dozens of stators working at once, these nudges quickly spin the propeller. I'm writing an essay for Asimov Press about this now, and am really enjoying learning about the flagellum and its history. It's an extraordinarily complicated structure, though, and has been a challenge to understand!

The bacterial flagellum looks like a simple tail, or whip. But it’s actually a rotating motor, and perhaps the most sophisticated protein complex nature has ever evolved. In e. coli, these motors are capable of astonishing speeds; about 15,000 rpm. (The world record, according to one study, is for a Vibrio cell that was “clocked at 100,000 rpm by laser microscopy.) The flagellum propels the cell forward at speeds of 20-30 microns per second, or roughly 15 body lengths per second. If scaled up to the size of a cheetah, E. coli would nearly be the fastest land organism. The darting movements of a microbe were first observed in 1676 by Antony van Leeuwenhoek, a Dutch cloth merchant. Antony was delighted by the motion of his “animalcules,” writing: “I must say, for my part, that no more pleasant sight has ever yet come before my eye than these many thousands of living creatures, seen all alive in a little drop of water, moving among one another, each several creature having its own proper motion.” But Leeuwenhoek did not see flagella. He assumed, rather, that these animalcules must be “furnished with paws” instead. Christian Ehrenberg would not properly describe flagella until 1836. But amazingly, all the way up until the 1970s, nobody actually knew how the flagellum spun! In 1973, there were two competing models people argued over: the helical-wave (bending) model and the rotating (corkscrew) model. The first model suggested that the flagellum whipped back and forth, side-to-side, to propel the cell like paddle. The corkscrew model suggested that the whole flagellum instead spins around like a screw. In 1974, the corkscrew model finally won out. For two separate studies, scientists affixed flagella to glass slides using antibodies, and watched as the cells spun around and around like corkscrews. And finally, in just the last year, high-resolution structures of the flagellum have revealed a LOT more about its intricate assembly. The tail is made from ~20,000 self-assembling copies of a single protein, called flagellin. A “driveshaft,” or rod, spins the tail and is itself made of 26 protein subunits. Each “motor” in E. coli consists of 11 stators, each of which is made from 7 proteins.(Other types of cells have even more stators, and swim with much higher torques.) The flagellum spins when protons flow into the cell through tiny channels in these stators; akin to water running through a turbine. Each proton makes a small part of the stator change shape and push against the rotor, nudging it forward one step. With dozens of stators working at once, these nudges quickly spin the propeller. I'm writing an essay for Asimov Press about this now, and am really enjoying learning about the flagellum and its history. It's an extraordinarily complicated structure, though, and has been a challenge to understand!

51,853 Aufrufe

Some microbes carry a protein, called SNIPE, that "chops up" phage DNA as it's being injected into the cell. This is a new mechanism for phage defense! CRISPR–Cas and restriction enzymes also evolved to fight against phages, but they work by recognizing sequences. SNIPE works, instead, by sensing "touch." SNIPE is a protein with about 500 amino acids. After it's made by the ribosome, it latches onto ManYZ, two proteins which sit on the cell's inner membrane. (ManYZ is an importer; it brings mannose and other sugars into the cell.) Once attached to ManYZ, SNIPE sits and waits for an invading phage. Some phages, including lambda, actually infect cells by pushing their DNA through this ManYZ channel. Lambda uses its "tail" to reach inside the protein channel, basically, and inject its DNA. When this physical touch happens, though, SNIPE is waiting. As soon as the phage DNA starts entering the cell, and passes through ManYZ and SNIPE, it gets immediately destroyed. This means that SNIPE is the first phage defense system discovered, so far, that uses spatial positioning at the injection site to destroy invaders. But there are caveats, of course. If you untether SNIPE from ManYZ, such that it can freely diffuse through the cell, it will chew up the bacterium's genome. It is not a highly discerning nuclease! Also, SNIPE is not found in most bacteria. A prior pangenome study, which sequenced lots of different microbes, found that roughly a third of well-studied bacterial lineages had at least one member with a SNIPE-like protein. (For this paper, they just ported one of those homologs into an E. coli laboratory strain.) And finally, because SNIPE's mechanism is tightly tied to ManYZ, it cannot be used to defend against phages that enter the cell through different routes. T4 phages, for example, inject their DNA straight through the cell membrane and into the cytoplasm, without interacting with ManYZ. This is a nice basic science paper. Applications TBD. (Just remember that scientists figured out that bacteria had a phage defense system, called CRISPR-Cas, many years before it was repurposed into a gene-editing tool.) P.S. The video below shows how cells with the SNIPE gene (middle row) kill invading phages, and thus continue growing and dividing. Empty vector (top row) refers to bacteria carrying a plasmid with no SNIPE gene; this is a control group. And SNIPE E414A refers to cells which received a mutated SNIPE gene, where the glutamate at position 414 has been changed to an alanine, thus destroying the protein's nuclease activity. These cells also die when they get infected with a phage.

Some microbes carry a protein, called SNIPE, that "chops up" phage DNA as it's being injected into the cell. This is a new mechanism for phage defense! CRISPR–Cas and restriction enzymes also evolved to fight against phages, but they work by recognizing sequences. SNIPE works, instead, by sensing "touch." SNIPE is a protein with about 500 amino acids. After it's made by the ribosome, it latches onto ManYZ, two proteins which sit on the cell's inner membrane. (ManYZ is an importer; it brings mannose and other sugars into the cell.) Once attached to ManYZ, SNIPE sits and waits for an invading phage. Some phages, including lambda, actually infect cells by pushing their DNA through this ManYZ channel. Lambda uses its "tail" to reach inside the protein channel, basically, and inject its DNA. When this physical touch happens, though, SNIPE is waiting. As soon as the phage DNA starts entering the cell, and passes through ManYZ and SNIPE, it gets immediately destroyed. This means that SNIPE is the first phage defense system discovered, so far, that uses spatial positioning at the injection site to destroy invaders. But there are caveats, of course. If you untether SNIPE from ManYZ, such that it can freely diffuse through the cell, it will chew up the bacterium's genome. It is not a highly discerning nuclease! Also, SNIPE is not found in most bacteria. A prior pangenome study, which sequenced lots of different microbes, found that roughly a third of well-studied bacterial lineages had at least one member with a SNIPE-like protein. (For this paper, they just ported one of those homologs into an E. coli laboratory strain.) And finally, because SNIPE's mechanism is tightly tied to ManYZ, it cannot be used to defend against phages that enter the cell through different routes. T4 phages, for example, inject their DNA straight through the cell membrane and into the cytoplasm, without interacting with ManYZ. This is a nice basic science paper. Applications TBD. (Just remember that scientists figured out that bacteria had a phage defense system, called CRISPR-Cas, many years before it was repurposed into a gene-editing tool.) P.S. The video below shows how cells with the SNIPE gene (middle row) kill invading phages, and thus continue growing and dividing. Empty vector (top row) refers to bacteria carrying a plasmid with no SNIPE gene; this is a control group. And SNIPE E414A refers to cells which received a mutated SNIPE gene, where the glutamate at position 414 has been changed to an alanine, thus destroying the protein's nuclease activity. These cells also die when they get infected with a phage.

20,321 Aufrufe

I just moved to Berkeley, and unpacking was a good excuse to catalog the books in my library. I currently own 450 physical books, of which 18% are fiction and 82% are nonfiction. About 25% of my nonfiction books are about biology, which was surprising to me because I don’t really enjoy reading about biology in my spare time. When I shared my bookshelf with Claude and asked for recommendations, it suggested The Invention of Air by Steven Johnson, The Making of the Atomic Bomb by Richard Rhodes, and The Metaphysical Club by Louis Menand. The first two were already on my list, but I had never heard of the third. Overall, I think a digital bookshelf is a useful way to find more books based on my interests. My full bookshelf is here:

I just moved to Berkeley, and unpacking was a good excuse to catalog the books in my library. I currently own 450 physical books, of which 18% are fiction and 82% are nonfiction. About 25% of my nonfiction books are about biology, which was surprising to me because I don’t really enjoy reading about biology in my spare time. When I shared my bookshelf with Claude and asked for recommendations, it suggested The Invention of Air by Steven Johnson, The Making of the Atomic Bomb by Richard Rhodes, and The Metaphysical Club by Louis Menand. The first two were already on my list, but I had never heard of the third. Overall, I think a digital bookshelf is a useful way to find more books based on my interests. My full bookshelf is here:

14,452 Aufrufe

We made a huge poster that illustrates all of the major genome editing tools in one place. You can download a copy for free from the Asimov Press website.

We made a huge poster that illustrates all of the major genome editing tools in one place. You can download a copy for free from the Asimov Press website.

40,561 Aufrufe

This video shows a subset of ribosomes inside a cancer cell actively translating mRNA molecules. Each point of light is one ribosome. An image was taken every 3 minutes over a 4-hour period.

This video shows a subset of ribosomes inside a cancer cell actively translating mRNA molecules. Each point of light is one ribosome. An image was taken every 3 minutes over a 4-hour period.

35,203 Aufrufe

In 2007, physicist Freeman Dyson wrote an essay called “Our Biotech Future” for The New York Review. In it, he wrote: “I see a bright future for the biotechnology industry when it follows the path of the computer industry…becoming small and domesticated rather than big and centralized.” Dyson had recently visited the Philadelphia Flower Show, “the biggest indoor flower show in the world, where flower breeders from all over the world show off the results of their efforts.” And he pondered a future where genetic engineering would enable these breeders to make entirely new types of flowers, unencumbered by the biological limits of evolution. It seems that Dyson’s “biotech future” is now becoming reality. Nick Desnoyer, a postdoctoral fellow in the United Kingdom, has already designed and created more than a dozen bespoke flowers. Desnoyer imagines phenotypes in his head and then uses a combination of breeding, CRISPR, and pathogens to manifest those phenotypes in his flowers. He’s currently working to add new colors to his design palette, including streaks of yellow, amber, purple, and green. All of his flowers are sculpted on nights and weekends, after lab mates have shuffled home for the night. I’m writing an essay about Nick and his process for Asimov Press, called "The Flower Designer." More to share soon! Video below is from Nick's website -->

In 2007, physicist Freeman Dyson wrote an essay called “Our Biotech Future” for The New York Review. In it, he wrote: “I see a bright future for the biotechnology industry when it follows the path of the computer industry…becoming small and domesticated rather than big and centralized.” Dyson had recently visited the Philadelphia Flower Show, “the biggest indoor flower show in the world, where flower breeders from all over the world show off the results of their efforts.” And he pondered a future where genetic engineering would enable these breeders to make entirely new types of flowers, unencumbered by the biological limits of evolution. It seems that Dyson’s “biotech future” is now becoming reality. Nick Desnoyer, a postdoctoral fellow in the United Kingdom, has already designed and created more than a dozen bespoke flowers. Desnoyer imagines phenotypes in his head and then uses a combination of breeding, CRISPR, and pathogens to manifest those phenotypes in his flowers. He’s currently working to add new colors to his design palette, including streaks of yellow, amber, purple, and green. All of his flowers are sculpted on nights and weekends, after lab mates have shuffled home for the night. I’m writing an essay about Nick and his process for Asimov Press, called "The Flower Designer." More to share soon! Video below is from Nick's website -->

21,751 Aufrufe

A 3D map of mRNA transcripts in a zebrafish embryo. This video was not made using a microscope. Researchers tag nucleotides with barcodes, which then "link" together in the tissue. Sequencing those links can then be used to computationally infer the 3D positions of genes.

A 3D map of mRNA transcripts in a zebrafish embryo. This video was not made using a microscope. Researchers tag nucleotides with barcodes, which then "link" together in the tissue. Sequencing those links can then be used to computationally infer the 3D positions of genes.

24,302 Aufrufe

Cable bacteria are long, "filamentous bacteria that conduct electrons via internal wires." New study: Anaerobes — in lakes and ponds — swarm around these cable bacteria & give electrons for respiration. Cut the cable, lose the microbes. Beautiful. 📽️

Cable bacteria are long, "filamentous bacteria that conduct electrons via internal wires." New study: Anaerobes — in lakes and ponds — swarm around these cable bacteria & give electrons for respiration. Cut the cable, lose the microbes. Beautiful. 📽️

33,745 Aufrufe

Videos

Anya Rossi

sweetdream.ai

SweetDream.ai•Sponsored•Livecam

Watch Anya Live

Anya is streaming live right now! Join her private show and enjoy exclusive content.

Exclusive private shows

1.2k viewers online

Private Show

Join now for exclusive access

Free preview available • Premium content

The Magnetobiology Episode: A company in San Francisco, called Nonfiction Laboratories, is building proteins (like antibodies and enzymes) that can be controlled using small magnets. In this episode, co-founder Maria Ingaramo and scientific advisor Andrew York explain how they engineered a protein, MagLOV, that responds strongly to magnetic fields, why most prior attempts have failed to replicate, and how the mechanism of magnetically-controlled proteins actually works. They also get into the “dream” use cases, like cancer drugs that activate only at the tumor, which might have a lower toxicity inside the body. This podcast is made possible by Astera Institute. I'm happy with how this episode came out. I think my interviewing skills are improving, and I'm getting better at building up context throughout the episode. Enjoy! Search for "The New Biology" on YouTube, Spotify, and Apple Podcasts. Timestamps: 00:00 - Opening 00:54 — Introduction 01:35 — The dream 05:38 — Why magnets vs. light or ultrasound 10:05 — The physics 17:48 — On the name "magnetogenetics" 21:25 — Birds and cryptochromes 27:09 — Why is the field filled with so much junk? 29:51 — Adam Cohen's molecule 33:24 — Markus Meister’s debunking 38:06 — The experiment 46:22 — Finding the LOV domain 54:11 — Singlets, triplets, and cysteine 56:54 — What the magnet is actually doing 1:05:13 — The conformational-change red herring 1:12:46 — The Quantum Biology Institute 1:19:31 — Founding Nonfiction Labs 1:24:38 — How to convince skeptical investors 1:29:39 — What a magnetogenetic medicine might look like 1:38:50 — First clinical indications 1:45:12 — The regulatory path 1:48:01 — What the field needs 1:54:30 — Appendix: Whiteboard lecture

The Magnetobiology Episode: A company in San Francisco, called Nonfiction Laboratories, is building proteins (like antibodies and enzymes) that can be controlled using small magnets. In this episode, co-founder Maria Ingaramo and scientific advisor Andrew York explain how they engineered a protein, MagLOV, that responds strongly to magnetic fields, why most prior attempts have failed to replicate, and how the mechanism of magnetically-controlled proteins actually works. They also get into the “dream” use cases, like cancer drugs that activate only at the tumor, which might have a lower toxicity inside the body. This podcast is made possible by Astera Institute. I'm happy with how this episode came out. I think my interviewing skills are improving, and I'm getting better at building up context throughout the episode. Enjoy! Search for "The New Biology" on YouTube, Spotify, and Apple Podcasts. Timestamps: 00:00 - Opening 00:54 — Introduction 01:35 — The dream 05:38 — Why magnets vs. light or ultrasound 10:05 — The physics 17:48 — On the name "magnetogenetics" 21:25 — Birds and cryptochromes 27:09 — Why is the field filled with so much junk? 29:51 — Adam Cohen's molecule 33:24 — Markus Meister’s debunking 38:06 — The experiment 46:22 — Finding the LOV domain 54:11 — Singlets, triplets, and cysteine 56:54 — What the magnet is actually doing 1:05:13 — The conformational-change red herring 1:12:46 — The Quantum Biology Institute 1:19:31 — Founding Nonfiction Labs 1:24:38 — How to convince skeptical investors 1:29:39 — What a magnetogenetic medicine might look like 1:38:50 — First clinical indications 1:45:12 — The regulatory path 1:48:01 — What the field needs 1:54:30 — Appendix: Whiteboard lecture

24,767 Aufrufe • vor 6 Tagen

There is a new paper in Science proposing a mechanism for how homing pigeons navigate on cloudy days. (Hint: It's magnetic fields.) As with many magnetobiology papers, though, I'm skeptical of their proposed mechanism. These researchers, from Germany, found that pigeons have macrophages in their liver that accumulate lots of iron. They confirmed this with staining and other analyses. These macrophages also tend to cluster near nerve fibers in the liver (this is important for later). Then they did a really interesting experiment: - Train 34 pigeons to fly a particular 19-kilometer route. Ensure they all do this well. - Split the pigeons into two groups: treatment and control. - Inject the treatment group pigeons with liposomes loaded with clodronate. The macrophages eat these liposomes, and then clodronate kills the cells and scatters the iron. - Release the pigeons, from both groups, on an overcast day (it's thought that pigeons use magnetic fields to navigate when there is no sun). - All of the control pigeons reached their destination within 70 minutes, but the treated pigeons scattered in random directions. - (Important control experiment: The treated pigeons, released on a sunny day, flew like normal and reached their destination.) - This is taken as evidence that ??? macrophages --> iron --> navigation ??? via magnetic fields. But the mechanism is fuzzy. This experiment is super interesting, and it's clear that the treated pigeons really are unable to home to their destination using a magnetic field. But I'm not entirely convinced by the mechanism these authors propose. The main claim is that these iron-loaded macrophages "align" in a magnetic field, and that they shift according to the bird's orientation so that it can fix its direction. These macrophages (somehow) send signals to the nerve fibers in the liver, which then pass the messages to the brain, which allows the bird to navigate. The news coverage for this story suggests how this might happen: "One idea is that as the bird shifts its position relative to Earth’s magnetic field lines, the ferritin changes orientation and tugs on the web of fibers within a macrophage, possibly triggering the release of signaling molecules." (All you need to do is read the 2016 Meister paper, from the images below, to understand why such a mechanism is physically dubious.) The problem, though, is that the authors show (in their own study) that the iron in these pigeons' livers only act as a stable magnet at super low temperatures, below about 12 degrees Kelvin (or -260 degrees Celsius). At normal, physiological temperatures, the iron would be scrambled by the thermal motions of the tissue. Every measurement in the paper is taken at cryogenic temperatures, but a bird's body temperature is much higher, which means heat would likely destroy any magnetic alignment. The authors claim that MILLIONS of iron particles in the liver are all acting together to escape this effect, but they don't demonstrate the mechanism convincingly at all. If this claim is true, why not take homing pigeons (control vs. macrophage-depleted) and then rotate a magnetic field around them? You could record their neurons to see if there is some kind of signal coming from the liver.

There is a new paper in Science proposing a mechanism for how homing pigeons navigate on cloudy days. (Hint: It's magnetic fields.) As with many magnetobiology papers, though, I'm skeptical of their proposed mechanism. These researchers, from Germany, found that pigeons have macrophages in their liver that accumulate lots of iron. They confirmed this with staining and other analyses. These macrophages also tend to cluster near nerve fibers in the liver (this is important for later). Then they did a really interesting experiment: - Train 34 pigeons to fly a particular 19-kilometer route. Ensure they all do this well. - Split the pigeons into two groups: treatment and control. - Inject the treatment group pigeons with liposomes loaded with clodronate. The macrophages eat these liposomes, and then clodronate kills the cells and scatters the iron. - Release the pigeons, from both groups, on an overcast day (it's thought that pigeons use magnetic fields to navigate when there is no sun). - All of the control pigeons reached their destination within 70 minutes, but the treated pigeons scattered in random directions. - (Important control experiment: The treated pigeons, released on a sunny day, flew like normal and reached their destination.) - This is taken as evidence that ??? macrophages --> iron --> navigation ??? via magnetic fields. But the mechanism is fuzzy. This experiment is super interesting, and it's clear that the treated pigeons really are unable to home to their destination using a magnetic field. But I'm not entirely convinced by the mechanism these authors propose. The main claim is that these iron-loaded macrophages "align" in a magnetic field, and that they shift according to the bird's orientation so that it can fix its direction. These macrophages (somehow) send signals to the nerve fibers in the liver, which then pass the messages to the brain, which allows the bird to navigate. The news coverage for this story suggests how this might happen: "One idea is that as the bird shifts its position relative to Earth’s magnetic field lines, the ferritin changes orientation and tugs on the web of fibers within a macrophage, possibly triggering the release of signaling molecules." (All you need to do is read the 2016 Meister paper, from the images below, to understand why such a mechanism is physically dubious.) The problem, though, is that the authors show (in their own study) that the iron in these pigeons' livers only act as a stable magnet at super low temperatures, below about 12 degrees Kelvin (or -260 degrees Celsius). At normal, physiological temperatures, the iron would be scrambled by the thermal motions of the tissue. Every measurement in the paper is taken at cryogenic temperatures, but a bird's body temperature is much higher, which means heat would likely destroy any magnetic alignment. The authors claim that MILLIONS of iron particles in the liver are all acting together to escape this effect, but they don't demonstrate the mechanism convincingly at all. If this claim is true, why not take homing pigeons (control vs. macrophage-depleted) and then rotate a magnetic field around them? You could record their neurons to see if there is some kind of signal coming from the liver.

21,889 Aufrufe • vor 6 Tagen

This robot is controlled by a fungus. The fungus' mycelia senses the environment and emits "action potential–like spiking voltages" to control the motors and valves.

This robot is controlled by a fungus. The fungus' mycelia senses the environment and emits "action potential–like spiking voltages" to control the motors and valves.

467,707 Aufrufe • vor 1 Jahr

My first podcast is out today with Mark Budde 🦕🏆, CEO of plasmidsaurus. Plasmidsaurus took whole-plasmid sequencing from $600 to $15 and turned a "boring" service company idea into a hugely successful company that now serves >70,000 scientists. We talked about what it means to build a "boring" company, whether the Plasmidsaurus idea could apply to other technologies (like CRISPR screens), and why Plasmidsaurus isn't expanding into China. This podcast is made possible by Astera Institute. 00:00 – Enter Plasmidsaurus 01:21 – Reducing sequencing costs by 40x 04:17 – Scaling Oxford Nanopore technology 06:29 – Venture capital and building a "boring" company 13:03 – Plasmidsaurus vs. traditional CROs 22:25 – On selling customer data 30:10 – Building a moat 37:08 – 50-minute results 39:26 – Logistics and the UPS partnership 48:42 – The Chinese market 50:20 – Playbook for new biotech founders 52:31 – The future of biological reasoning and AI You can find the podcast, THE NEW BIOLOGY, on YouTube, Spotify, and everywhere else.

My first podcast is out today with Mark Budde 🦕🏆, CEO of plasmidsaurus. Plasmidsaurus took whole-plasmid sequencing from $600 to $15 and turned a "boring" service company idea into a hugely successful company that now serves >70,000 scientists. We talked about what it means to build a "boring" company, whether the Plasmidsaurus idea could apply to other technologies (like CRISPR screens), and why Plasmidsaurus isn't expanding into China. This podcast is made possible by Astera Institute. 00:00 – Enter Plasmidsaurus 01:21 – Reducing sequencing costs by 40x 04:17 – Scaling Oxford Nanopore technology 06:29 – Venture capital and building a "boring" company 13:03 – Plasmidsaurus vs. traditional CROs 22:25 – On selling customer data 30:10 – Building a moat 37:08 – 50-minute results 39:26 – Logistics and the UPS partnership 48:42 – The Chinese market 50:20 – Playbook for new biotech founders 52:31 – The future of biological reasoning and AI You can find the podcast, THE NEW BIOLOGY, on YouTube, Spotify, and everywhere else.

28,952 Aufrufe • vor 27 Tagen

This video is one of the first times I thought biology was “cool.” It shows a neutrophil cell chasing a bacterium. Originally recorded in the 1950s by David Rogers at Vanderbilt University, the video gave me a deeper appreciation for life, even at the level of a single cell, because the neutrophil's movements seem so intentful, purposeful, aware. It wasn’t until recently, though, that I actually tried to demystify the neutrophil’s movements and understand how they happen. Here's what I learned: 1. The neutrophil's surface has thousands of protein receptors. Molecules secreted by the bacteria collide with these receptors. When that happens, the proteins change shape, slightly, and initiate a signaling cascade. 2. The neutrophil “knows” where to go because of a discrepancy in bound vs. unbound receptors. The side of the cell closest to the microbe will, probabilistically, have more "bound" receptors than the other side (because the molecules secreted by the microbe have a concentration gradient). This is how the neutrophil figures out which way to move. 3. Each bound receptor activates several G proteins located inside the cell membrane. Each G protein, in turn, switches on PI3K enzymes. In this way, the original signal is amplified; a single "activated" receptor might cause ~100 copies of PI3K to get switched on downstream. 4. The PI3K enzymes stick phosphates onto lipids in the cell membrane. The side of the neutrophil facing the bacterium now has more phosphates than the "back" side. Phosphate-binding proteins, such as GEF, accumulate and then recruit Rac, thus activating it. Rac, in turn, acts like a molecular switch, ultimately recruiting Arp2/3. (TL;DR: A bunch of proteins get activated, and the high phosphate concentration at the leading edge is the key signal for all this.) 5. At any given moment, the neutrophil has millions of actin molecules. These are the proteins used to build the cytoskeleton. Half of the actins are already “assembled” into filaments, but the other half are just floating around. Arp2/3 acts as a nucleator, grabbing onto actin and then starting a new cytoskeletal branch. More actin is assembled at the leading edge (where the Arp2/3 has accumulated), where they each push on the cell membrane with ~2 piconewtons of force. Hundreds of actin chains, pushing together, causes the cell to form protrusions. 6. The assembling actin chains push the cell at a speed of ~20 micrometers per minute (the length of about ten E. coli cells placed end-to-end.) As all of this is happening, another signaling cascade, nucleated at the back end of the cell, is dismantling actin filaments and recycling them. All this happens over a span of about 30 seconds. Much of this process is invisible; what we see, instead, is "just" a cell chasing its prey. But that's the wonderful thing about biology: A singular observation is usually more than enough fodder for a lifetime of work. The well is deep. There is always more to learn.

This video is one of the first times I thought biology was “cool.” It shows a neutrophil cell chasing a bacterium. Originally recorded in the 1950s by David Rogers at Vanderbilt University, the video gave me a deeper appreciation for life, even at the level of a single cell, because the neutrophil's movements seem so intentful, purposeful, aware. It wasn’t until recently, though, that I actually tried to demystify the neutrophil’s movements and understand how they happen. Here's what I learned: 1. The neutrophil's surface has thousands of protein receptors. Molecules secreted by the bacteria collide with these receptors. When that happens, the proteins change shape, slightly, and initiate a signaling cascade. 2. The neutrophil “knows” where to go because of a discrepancy in bound vs. unbound receptors. The side of the cell closest to the microbe will, probabilistically, have more "bound" receptors than the other side (because the molecules secreted by the microbe have a concentration gradient). This is how the neutrophil figures out which way to move. 3. Each bound receptor activates several G proteins located inside the cell membrane. Each G protein, in turn, switches on PI3K enzymes. In this way, the original signal is amplified; a single "activated" receptor might cause ~100 copies of PI3K to get switched on downstream. 4. The PI3K enzymes stick phosphates onto lipids in the cell membrane. The side of the neutrophil facing the bacterium now has more phosphates than the "back" side. Phosphate-binding proteins, such as GEF, accumulate and then recruit Rac, thus activating it. Rac, in turn, acts like a molecular switch, ultimately recruiting Arp2/3. (TL;DR: A bunch of proteins get activated, and the high phosphate concentration at the leading edge is the key signal for all this.) 5. At any given moment, the neutrophil has millions of actin molecules. These are the proteins used to build the cytoskeleton. Half of the actins are already “assembled” into filaments, but the other half are just floating around. Arp2/3 acts as a nucleator, grabbing onto actin and then starting a new cytoskeletal branch. More actin is assembled at the leading edge (where the Arp2/3 has accumulated), where they each push on the cell membrane with ~2 piconewtons of force. Hundreds of actin chains, pushing together, causes the cell to form protrusions. 6. The assembling actin chains push the cell at a speed of ~20 micrometers per minute (the length of about ten E. coli cells placed end-to-end.) As all of this is happening, another signaling cascade, nucleated at the back end of the cell, is dismantling actin filaments and recycling them. All this happens over a span of about 30 seconds. Much of this process is invisible; what we see, instead, is "just" a cell chasing its prey. But that's the wonderful thing about biology: A singular observation is usually more than enough fodder for a lifetime of work. The well is deep. There is always more to learn.

127,071 Aufrufe • vor 4 Monaten

I've started writing my book: "Biology is a Burrito & Other Essays." It is an interactive and highly visual look into the beauty, speed, and complexity of a living cell. I'm planning to print hardcover books while serializing the essays online. The first essay is now available at This was inspired by Stewart Brand's latest book, "Maintenance of Everything," which he developed in serialized form with Works in Progress. One cool thing about that book was that he improved each chapter with reader comments before printing the physical copies! I'll be doing the same with this book. If you send me feedback that improves the text, I'll credit you online and in the final print version. You can also sign up to get email updates when a new essay launches. Hope you enjoy!

33,943 Aufrufe • vor 1 Monat

A green alga cell can swim 100 microns per second. Scientists put little baskets on a wheel. As algae became trapped, they pushed and spun the wheel around.

A green alga cell can swim 100 microns per second. Scientists put little baskets on a wheel. As algae became trapped, they pushed and spun the wheel around.

351,666 Aufrufe • vor 1 Jahr

A 3D structural model of an entire bacterial cell. Biology is the coolest thing ever.

A 3D structural model of an entire bacterial cell. Biology is the coolest thing ever.

170,547 Aufrufe • vor 2 Jahren

Our second book is now available for pre-order. 🎉 Embracing the book's technology theme, we did something special: We encoded the entire book into DNA & packaged it into stainless steel capsules, where it will live for tens of thousands of years. 1,000 copies were made... 🧵

Our second book is now available for pre-order. 🎉 Embracing the book's technology theme, we did something special: We encoded the entire book into DNA & packaged it into stainless steel capsules, where it will live for tens of thousands of years. 1,000 copies were made... 🧵

102,911 Aufrufe • vor 1 Jahr

I made an interactive enzyme simulator. Change the temperature, add or remove inhibitors, and tune the probability that enzymes bind their substrates. Watch as the reaction rate moves up or down in real-time. Maybe this will be a helpful teaching tool.

I made an interactive enzyme simulator. Change the temperature, add or remove inhibitors, and tune the probability that enzymes bind their substrates. Watch as the reaction rate moves up or down in real-time. Maybe this will be a helpful teaching tool.

60,563 Aufrufe • vor 9 Monaten

The bacterial flagellum looks like a simple tail, or whip. But it’s actually a rotating motor, and perhaps the most sophisticated protein complex nature has ever evolved. In e. coli, these motors are capable of astonishing speeds; about 15,000 rpm. (The world record, according to one study, is for a Vibrio cell that was “clocked at 100,000 rpm by laser microscopy.) The flagellum propels the cell forward at speeds of 20-30 microns per second, or roughly 15 body lengths per second. If scaled up to the size of a cheetah, E. coli would *nearly* be the fastest land organism. The darting movements of a microbe were first observed in 1676 by Antony van Leeuwenhoek, a Dutch cloth merchant. Antony was delighted by the motion of his “animalcules,” writing: “I must say, for my part, that no more pleasant sight has ever yet come before my eye than these many thousands of living creatures, seen all alive in a little drop of water, moving among one another, each several creature having its own proper motion.” But Leeuwenhoek did not see flagella. He assumed, rather, that these animalcules must be “furnished with paws” instead. Christian Ehrenberg would not properly describe flagella until 1836. But amazingly, all the way up until the 1970s, nobody actually knew how the flagellum spun! In 1973, there were two competing models people argued over: the helical-wave (bending) model and the rotating (corkscrew) model. The first model suggested that the flagellum whipped back and forth, side-to-side, to propel the cell like paddle. The corkscrew model suggested that the whole flagellum instead spins around like a screw. In 1974, the corkscrew model finally won out. For two separate studies, scientists affixed flagella to glass slides using antibodies, and watched as the cells spun around and around like corkscrews. And finally, in just the last year, high-resolution structures of the flagellum have revealed a LOT more about its intricate assembly. The tail is made from ~20,000 self-assembling copies of a single protein, called flagellin. A “driveshaft,” or rod, spins the tail and is itself made of 26 protein subunits. Each “motor” in E. coli consists of 11 stators, each of which is made from 7 proteins.(Other types of cells have even more stators, and swim with much higher torques.) The flagellum spins when protons flow into the cell through tiny channels in these stators; akin to water running through a turbine. Each proton makes a small part of the stator change shape and push against the rotor, nudging it forward one step. With dozens of stators working at once, these nudges quickly spin the propeller. I'm writing an essay for Asimov Press about this now, and am really enjoying learning about the flagellum and its history. It's an extraordinarily complicated structure, though, and has been a challenge to understand!

The bacterial flagellum looks like a simple tail, or whip. But it’s actually a rotating motor, and perhaps the most sophisticated protein complex nature has ever evolved. In e. coli, these motors are capable of astonishing speeds; about 15,000 rpm. (The world record, according to one study, is for a Vibrio cell that was “clocked at 100,000 rpm by laser microscopy.) The flagellum propels the cell forward at speeds of 20-30 microns per second, or roughly 15 body lengths per second. If scaled up to the size of a cheetah, E. coli would nearly be the fastest land organism. The darting movements of a microbe were first observed in 1676 by Antony van Leeuwenhoek, a Dutch cloth merchant. Antony was delighted by the motion of his “animalcules,” writing: “I must say, for my part, that no more pleasant sight has ever yet come before my eye than these many thousands of living creatures, seen all alive in a little drop of water, moving among one another, each several creature having its own proper motion.” But Leeuwenhoek did not see flagella. He assumed, rather, that these animalcules must be “furnished with paws” instead. Christian Ehrenberg would not properly describe flagella until 1836. But amazingly, all the way up until the 1970s, nobody actually knew how the flagellum spun! In 1973, there were two competing models people argued over: the helical-wave (bending) model and the rotating (corkscrew) model. The first model suggested that the flagellum whipped back and forth, side-to-side, to propel the cell like paddle. The corkscrew model suggested that the whole flagellum instead spins around like a screw. In 1974, the corkscrew model finally won out. For two separate studies, scientists affixed flagella to glass slides using antibodies, and watched as the cells spun around and around like corkscrews. And finally, in just the last year, high-resolution structures of the flagellum have revealed a LOT more about its intricate assembly. The tail is made from ~20,000 self-assembling copies of a single protein, called flagellin. A “driveshaft,” or rod, spins the tail and is itself made of 26 protein subunits. Each “motor” in E. coli consists of 11 stators, each of which is made from 7 proteins.(Other types of cells have even more stators, and swim with much higher torques.) The flagellum spins when protons flow into the cell through tiny channels in these stators; akin to water running through a turbine. Each proton makes a small part of the stator change shape and push against the rotor, nudging it forward one step. With dozens of stators working at once, these nudges quickly spin the propeller. I'm writing an essay for Asimov Press about this now, and am really enjoying learning about the flagellum and its history. It's an extraordinarily complicated structure, though, and has been a challenge to understand!

51,853 Aufrufe • vor 9 Monaten

Read Something Wonderful (about Biology) We just released a curated list of 125+ essays about biology and science. These articles cover pharmaceuticals, the history of molecular biology, timeless arguments and theories, and more. Check it out.🔻

Read Something Wonderful (about Biology) We just released a curated list of 125+ essays about biology and science. These articles cover pharmaceuticals, the history of molecular biology, timeless arguments and theories, and more. Check it out.🔻

28,706 Aufrufe • vor 6 Monaten

E. coli copies 600 bases of DNA/second. It makes one error every few billion bases, or one mutation per 1,000 generations. I made an animation to show just how crazy this is. Every green square is a copied nucleotide. The red squares (very rare) are mutations. 🔻

E. coli copies 600 bases of DNA/second. It makes one error every few billion bases, or one mutation per 1,000 generations. I made an animation to show just how crazy this is. Every green square is a copied nucleotide. The red squares (very rare) are mutations. 🔻

38,651 Aufrufe • vor 9 Monaten

Beautiful paper. Scientists solved the structure of myosin—the protein that forms contractile filaments in muscle cells—in multiple configurations using Cryo-EM. They captured the entire power stroke action (where myosin pulls on actin to shorten the muscle) at4.4 Å resolution.

Beautiful paper. Scientists solved the structure of myosin—the protein that forms contractile filaments in muscle cells—in multiple configurations using Cryo-EM. They captured the entire power stroke action (where myosin pulls on actin to shorten the muscle) at4.4 Å resolution.

45,189 Aufrufe • vor 1 Jahr

I built an interactive visualization of the Central Dogma. You can speed it up or slow it down. You can set the length of genes, the initiation rates of ribosomes, protein decay rates, and more.

I built an interactive visualization of the Central Dogma. You can speed it up or slow it down. You can set the length of genes, the initiation rates of ribosomes, protein decay rates, and more.

30,904 Aufrufe • vor 9 Monaten

Scientists made a robot that can trap, rotate, and inject C. elegans worms. Straight into the gonads. The robot can make transgenic worms ~2-3x faster than expert humans. Remember: Progress in biology is correlated with how fast we can do experiments. More robots, please.

Scientists made a robot that can trap, rotate, and inject C. elegans worms. Straight into the gonads. The robot can make transgenic worms ~2-3x faster than expert humans. Remember: Progress in biology is correlated with how fast we can do experiments. More robots, please.

40,821 Aufrufe • vor 1 Jahr

Golgi apparatus of Chlamydomonas, a type of green algae. From

Golgi apparatus of Chlamydomonas, a type of green algae. From

44,282 Aufrufe • vor 2 Jahren

The Asimov Press podcast is coming soon. My first episode is on using AI to create new antibiotics with César de la Fuente. Here is the first ~3.5 minutes of an hour-long episode. Also, I'm looking for a video editor to help me out! Please DM if you're interested.

The Asimov Press podcast is coming soon. My first episode is on using AI to create new antibiotics with César de la Fuente. Here is the first ~3.5 minutes of an hour-long episode. Also, I'm looking for a video editor to help me out! Please DM if you're interested.

12,593 Aufrufe • vor 8 Monaten

Another YouTube Channel Idea: "E. coli Design." A whole series where you explain how to design DNA to change the behavior or appearance of E. coli cells. All you'd need is some equipment to transform cells, a microscope and camera, and some basic molecular biology equipment. Some ideas for modules: 1. The basics of a transcription unit; inserting GFP into cells and watching them glow. 2. Using a base editor to change GFP into another color? 3. Engineering E. coli to spin around in circles. 4. Engineering E. coli to swim faster, or to grow larger, or to partition their DNA unevenly, etc. ... and then end the series with the repressilator and blinking bacteria or something. You could inspire tens of thousands of future bioengineers and completely demystify this space. Plus it's so cool to directly show how DNA sequences can lead to physical, observable changes in the cell.

Another YouTube Channel Idea: "E. coli Design." A whole series where you explain how to design DNA to change the behavior or appearance of E. coli cells. All you'd need is some equipment to transform cells, a microscope and camera, and some basic molecular biology equipment. Some ideas for modules: 1. The basics of a transcription unit; inserting GFP into cells and watching them glow. 2. Using a base editor to change GFP into another color? 3. Engineering E. coli to spin around in circles. 4. Engineering E. coli to swim faster, or to grow larger, or to partition their DNA unevenly, etc. ... and then end the series with the repressilator and blinking bacteria or something. You could inspire tens of thousands of future bioengineers and completely demystify this space. Plus it's so cool to directly show how DNA sequences can lead to physical, observable changes in the cell.

11,229 Aufrufe • vor 10 Monaten

Asimov Press. Book Unboxing. Encoded in English and DNA. Designed by Everything Studio | Brooklyn, NY Printed by Shapco | Minneapolis, MN Published by Asimov Press | San Francisco, CA CATGATGACAGCTAGCGTCTAAGCCATTGTTGTTCGACG

Asimov Press. Book Unboxing. Encoded in English and DNA. Designed by Everything Studio | Brooklyn, NY Printed by Shapco | Minneapolis, MN Published by Asimov Press | San Francisco, CA CATGATGACAGCTAGCGTCTAAGCCATTGTTGTTCGACG

11,460 Aufrufe • vor 1 Jahr

Keine weiteren Inhalte verfügbar